| Primary Identifier | MGI:7618352 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sh3bp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CACACGGTACTAAGGATCCG and GCTGAAAGCTCTGTAAAAGT. This resulted in a 508 bp internal deletion of Chr15:78,904,108-78,904,615 (GRCm38/mm10) that removes exons ENSMUSE00001261102 and ENSMUSE00001241677. |
