| Primary Identifier | MGI:7616951 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Fxn |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 127 (GGC) in exon 4 was changed to valine (GTC) (c.380G>T:p.G127V) using an sgRNA (equivalent to TGCCACCTGACCCCCTAGGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.389G>T:p.G130V human mutation associated with Friedreich ataxia (FRDA). Transcription from this allele is normal, but translation is at about 5% of normal. |
