|  Help  |  About  |  Contact Us

Allele : Fxn<em8Lutzy> frataxin; endonuclease-mediated mutation 8, Cathy Lutz

Primary Identifier  MGI:7616951 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Fxn
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glycine codon 127 (GGC) in exon 4 was changed to valine (GTC) (c.380G>T:p.G127V) using an sgRNA (equivalent to TGCCACCTGACCCCCTAGGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.389G>T:p.G130V human mutation associated with Friedreich ataxia (FRDA). Transcription from this allele is normal, but translation is at about 5% of normal.
  • mutations:
  • Single point mutation
  • synonyms:
  • Fxn<G127V>,
  • Fxn<G127V>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele