| Primary Identifier | MGI:7642171 | Allele Type | Endonuclease-mediated |
| Gene | Usp24 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Cysteine codon 1695 (TGT) in exon 43 was changed to alanine (GCT) (p.C1695A) using an sgRNA (equivalent to ACGGTGGCGCCACTGCTTACATGAATGCAGTGTTCCAGCAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the peptidase activity of the encoded peptide. |
