|  Help  |  About  |  Contact Us

Allele : Impg2<em2Bdph> interphotoreceptor matrix proteoglycan 2; endonuclease-mediated mutation 2, Benjamin Philpot

Primary Identifier  MGI:7619043 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Impg2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Tyrosine codon 250 (TAC) in exon 8 was changed to cysteine (TGC) (p.Y250C) using an sgRNA (equivalent to GATCGCTTCCCCAGAAGTTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human p.Y254C mutation associated with adult-onset vitelliform macular dystrophy (AVMD) and retinitis pigmentosa (RP).
  • mutations:
  • Single point mutation
  • synonyms:
  • Impg2<Y250C>,
  • Impg2<Y250C>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories