|  Help  |  About  |  Contact Us

Allele : Ms4a18<em1(IMPC)J> membrane-spanning 4-domains, subfamily A, member 18; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7643202 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ms4a18
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCATAACTTGGACATTACTG and GCTATTCTGTCAACTATTTC. This resulted in a 16,393 bp deletion of Chr19:10,997,295-11,013,687 (GRCm38/mm10) that removes exons ENSMUSE00001053564 through ENSMUSE00001006950.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories