|  Help  |  About  |  Contact Us

Allele : Epm2a<em1Pro> epilepsy, progressive myoclonic epilepsy, type 2 gene alpha; endonuclease-mediated mutation 1, Peter J Roach

Primary Identifier  MGI:7643617 Allele Type  Endonuclease-mediated
Gene  Epm2a Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Cysteine codon 265 (TGC) in exon 4 was changed to serine (TCT) (p.C265S) using an sgRNA (targeting GTGTATGTCCACTGCAACGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • LaforinC265S,
  • LaforinC265S
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories