| Primary Identifier | MGI:7643239 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hbb-bt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATAAGTGGTGAGATAGTAAG and ATGACAACCATATCTACACA. This resulted in a 1,769 bp deletion of Chr7:103,812,287-103,814,055(GRCm38/mm10) that removes exons ENSMUSE00000633129 through ENSMUSE00000633127. |
