| Primary Identifier | MGI:7645689 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Dph1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamine codon 41 (CAG) in exon 2 was changed to a stop codon (TAG) (c.121C>T:p.Q41*) using an sgRNA (equivalent to CCAGTTACAGGCTGCTGTCCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.Q46* mutation found in a patient with diphthamide deficiency syndrome 1 (developmental delay with short stature, dysmorphic facial features, and sparse hair 1, DEDSSH1). |
