| Primary Identifier | MGI:7645438 | Allele Type | Endonuclease-mediated |
| Attribute String | Inserted expressed sequence | Gene | Ywhaq |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The 3' end of exon 3, entire intron 3 and the 5' end of exon 4, where the exonic sequences code for 31 amino acids comprising alpha-helix 6, was replaced with exon sequence coding for the equivalent 31 amino acid sequence from the zeta gene (Ywhaz), using sgRNAs (equivalent to ACGTAAGTATATTTGACCCA and TTGTTTCTGTGAGTTGAAAA) and an ssODN template with CRISPR/Cas9 technology. |
