|  Help  |  About  |  Contact Us

Allele : Ywhaq<em1(Ywhaz)Lmit> tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta; endonuclease-mediated mutation 1, Lars M Ittner

Primary Identifier  MGI:7645438 Allele Type  Endonuclease-mediated
Attribute String  Inserted expressed sequence Gene  Ywhaq
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The 3' end of exon 3, entire intron 3 and the 5' end of exon 4, where the exonic sequences code for 31 amino acids comprising alpha-helix 6, was replaced with exon sequence coding for the equivalent 31 amino acid sequence from the zeta gene (Ywhaz), using sgRNAs (equivalent to ACGTAAGTATATTTGACCCA and TTGTTTCTGTGAGTTGAAAA) and an ssODN template with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • 14-3-3theta<zetaFx>,
  • 14-3-3theta<zetaFx>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

1 Expresses

Trail: Allele

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele