| Primary Identifier | MGI:7645439 | Allele Type | Endonuclease-mediated |
| Gene | Tardbp | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Asparagine codon 390 (AAT) in exon 6 was changed to aspartic acid (GAT) (p.N390D) using sgRNAs (equivalent to TGGGGGTCAGCATCAAATGC and GTCAGCATCAAATGCAGGAT) and an ssODN template with CRISPR/Cas9 technology. The mutation results in ALS-like phenotypes in mice at advanced ages with spinal cord motor neuron loss from age 6 months. |
