|  Help  |  About  |  Contact Us

Allele : Tardbp<em1Lmit> TAR DNA binding protein; endonuclease-mediated mutation 1, Lars M Ittner

Primary Identifier  MGI:7645439 Allele Type  Endonuclease-mediated
Gene  Tardbp Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Asparagine codon 390 (AAT) in exon 6 was changed to aspartic acid (GAT) (p.N390D) using sgRNAs (equivalent to TGGGGGTCAGCATCAAATGC and GTCAGCATCAAATGCAGGAT) and an ssODN template with CRISPR/Cas9 technology. The mutation results in ALS-like phenotypes in mice at advanced ages with spinal cord motor neuron loss from age 6 months.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tardbp<N390D>,
  • Tardbp<N390D>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele