| Primary Identifier | MGI:7645709 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | App |
| Strain of Origin | B6(Cg)-App<tm1.1Aduci>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A guide RNA (AGAGATCTCGGAAGTGAAGA) was designed to produce the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change a lysine (K) and methionine (M) in APP to asparagine (N) and leucine (L). This targetted mutation was made in App |