|  Help  |  About  |  Contact Us

Allele : App<em1Aduci> amyloid beta precursor protein; endonuclease-mediated mutation 1, Frank LaFerla

Primary Identifier  MGI:7645709 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  App
Strain of Origin  B6(Cg)-App<tm1.1Aduci>/J Is Recombinase  false
Is Wild Type  false
molecularNote  A guide RNA (AGAGATCTCGGAAGTGAAGA) was designed to produce the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change a lysine (K) and methionine (M) in APP to asparagine (N) and leucine (L). This targetted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14.
  • mutations:
  • Nucleotide substitutions
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories