|  Help  |  About  |  Contact Us

Allele : Slc10a5<em1(IMPC)J> solute carrier family 10 (sodium/bile acid cotransporter family), member 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7657540 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc10a5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TCATATTCTGTGCTAAGGGA and CTACTTTTGTTGGTGACCCC. This resulted in a 1,228 bp deletion of Chr3:10,334,329-10,335,556 (GRCm38/mm10) that removes exon ENSMUSE00000474119.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories