|  Help  |  About  |  Contact Us

Allele : Col4a5<em1Jhm> collagen, type IV, alpha 5; endonuclease-mediated mutation 1, Jeffrey H Miner

Primary Identifier  MGI:7645885 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Col4a5
Strain of Origin  FVB/NJ Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 1569 (CGA), shared between exon 50 and 51, was changed to a stop codon (TGA) (ENSMUSP00000108553:p.R1569*) using an sgRNA (equivalent to CAGCCATTCATTAGTCGGTA) and an ssODN template with CRISPR/Cas9 technology.
  • mutations:
  • Single point mutation
  • synonyms:
  • Col4a5<R1563X>,
  • Col4a5<R1563X>,
  • Col4a5-R1563X,
  • Col4a5-R1563X
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories