| Primary Identifier | MGI:7786613 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc52a2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (ATCCTTGGCAGGTCTCTGGC) was used to target the solute carrier protein 52, member 2 (Slc52a2) gene resulted in deletion in exon 4. Donor DNAs were originally designed to introduce an L344P missense variant, and L344P silent mutation. The allele in exon 4; TCTCTGGCAG//TGTGGTCTGT was captured as a byproduct. |
