|  Help  |  About  |  Contact Us

Allele : Slc52a2<em8Lutzy> solute carrier protein 52, member 2; endonuclease-mediated mutation 8, Cathy Lutz

Primary Identifier  MGI:7786613 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc52a2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (ATCCTTGGCAGGTCTCTGGC) was used to target the solute carrier protein 52, member 2 (Slc52a2) gene resulted in deletion in exon 4. Donor DNAs were originally designed to introduce an L344P missense variant, and L344P silent mutation. The allele in exon 4; TCTCTGGCAG//TGTGGTCTGT was captured as a byproduct.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele