|  Help  |  About  |  Contact Us

Allele : Mcm2<em1(IMPC)J> minichromosome maintenance complex component 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7657499 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mcm2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ACCCTCCAAAAACCAAAACA and CACCTGCTGGTGGTATATGA. This resulted in a 1098 bp deletion of region Chr6:88,892,685-88,893,782 (GRCm38/mm10) and removes exons ENSMUSE00000194955 and ENSMUSE00000194959.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories