| Primary Identifier | MGI:7786710 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr578 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Hoxb enhancer ENE retinoic acid response element (ENE-RARE) was targeted for binding site disruption using an sgRNA (equivalent to GAGGAGGAAGAGTTCATGGAG) and an ssODN template with CRISPR/Cas9 technology, changing it from AGTTCAtggagAGGCCA to ACCAAGtggacTGAATT. This allele was created in ES cells carrying the Rr577em2Krum alleles. |
