|  Help  |  About  |  Contact Us

Allele : Rr499<em4Jejo> regulatory region 499; endonuclease-mediated mutation 4, Jane E Johnson

Primary Identifier  MGI:7705115 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr499
Is Recombinase  false Is Wild Type  false
molecularNote  The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in a 1236 bp deletion (GRCm39:chr2:19435674-19436909) including the TC-box of the far and E-box of the near autoregulatory PTF1-binding motifs, which creates a new PTF1-binding motif.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ptf1a<AR2>,
  • Ptf1a<AR2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories