| Primary Identifier | MGI:7705115 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr499 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in a 1236 bp deletion (GRCm39:chr2:19435674-19436909) including the TC-box of the far and E-box of the near autoregulatory PTF1-binding motifs, which creates a new PTF1-binding motif. |
