|  Help  |  About  |  Contact Us

Allele : Rr500<em2Jejo> regulatory region 500; endonuclease-mediated mutation 2, Jane E Johnson

Primary Identifier  MGI:7705124 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr500
Is Recombinase  false Is Wild Type  false
molecularNote  The Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) using CRISPR/Cas9 technology, resulting in a 9 bp deletion containing the paired homeodomain (Pd-HD)-binding motif. This allele was created in conjunction with the Rr499em2Jejo allele.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ptf1a<AR-DNT2>,
  • Ptf1a<AR-DNT2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories