| Primary Identifier | MGI:7705113 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr499 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in a 1222 bp deletion (GRCm39:chr2:19435680-19436901) that includes the TC-box in the far autoregulatory PTF1-binding motif, a 14 bp deletion-insertion in the near PTF1-binding motif and mutations in its TC-box (chr2:19436920-19436933 replaced with TGCAGTCT). |