|  Help  |  About  |  Contact Us

Allele : Rr499<em3Jejo> regulatory region 499; endonuclease-mediated mutation 3, Jane E Johnson

Primary Identifier  MGI:7705113 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr499
Is Recombinase  false Is Wild Type  false
molecularNote  The Ptf1a 5' enhancer was targeted by three sgRNAs (equivalent to CACAAGTGGCGACATTCCCA, ATAACACATGTGCTGGGGCG and CCGCAGAGCACGCCAGTCCG) and two ssODN templates using CRISPR/Cas9 technology, resulting in a 1222 bp deletion (GRCm39:chr2:19435680-19436901) that includes the TC-box in the far autoregulatory PTF1-binding motif, a 14 bp deletion-insertion in the near PTF1-binding motif and mutations in its TC-box (chr2:19436920-19436933 replaced with TGCAGTCT).
  • mutations:
  • Nucleotide substitutions,
  • Intergenic deletion
  • synonyms:
  • Ptf1a<AR1>,
  • Ptf1a<AR1>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele