| Primary Identifier | MGI:7719856 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tubgcp5 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TCTTACACTTGTTAGAACTA and GATTTCTCACAGGAGGTCTC. This resulted in a 2,192 bp deletion of Chr7:55,798,614-55,800,805 (GRCm38/mm10) that removes exons ENSMUSE00001057379 through ENSMUSE00001055038. |
