| Primary Identifier | MGI:7705092 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr499 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 5' enhancer was targeted by two sgRNAs (equivalent to CACAAGTGGCGACATTCCCA and CCGCAGAGCACGCCAGTCCG) using CRISPR/Cas9 technology, resulting in an ~1.2 kb deletion including the near autoregulatory PTF1-binding motif up to and including the TC-box of the far PTF1-binding motif, leaving its E-box intact. This allele was created in conjunction with the Rr500em2Jejo allele. |
