| Primary Identifier | MGI:7705094 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr500 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) and an ssODN template using CRISPR/Cas9 technology, resulting in a 118 bp deletion (GRCm39:chr2:19463788-19463905) containing the paired homeodomain (Pd-HD)-binding motif. |