|  Help  |  About  |  Contact Us

Allele : Rr500<em3Jejo> regulatory region 500; endonuclease-mediated mutation 3, Jane E Johnson

Primary Identifier  MGI:7705094 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr500
Is Recombinase  false Is Wild Type  false
molecularNote  The Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) and an ssODN template using CRISPR/Cas9 technology, resulting in a 118 bp deletion (GRCm39:chr2:19463788-19463905) containing the paired homeodomain (Pd-HD)-binding motif.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Ptf1a<DNT118>,
  • Ptf1a<DNT118>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele