|  Help  |  About  |  Contact Us

Allele : Dnaaf10<em1(IMPC)J> dynein axonemal assembly factor 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7720842 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnaaf10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTATGTATTTTAGTTTAAT and AAATACTTATAAGTCTTCGA. This resulted in a 485 bp deletion of Chr11:17,222,117-17,222,601 (GRCm38/mm10) that removes exon ENSMUSE00001293067.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories