| Primary Identifier | MGI:7707822 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr504 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The SOX9-binding site CAACAAT (GRCm39:chr11:112108255-112108261) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to GGGCAAGCAAACCACAACAATGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGG. |