|  Help  |  About  |  Contact Us

Allele : Rr504<em2Takas> regulatory region 504; endonuclease-mediated mutation 2, Shuji Takada

Primary Identifier  MGI:7707822 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr504
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The SOX9-binding site CAACAAT (GRCm39:chr11:112108255-112108261) within the embryonic Sox9 testis enhancer was targeted using an sgRNA (equivalent to GGGCAAGCAAACCACAACAATGG) and an ssODN template with CRISPR/Cas9 technology, resulting in it being replaced with GGGGGGG.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • SOX9 BS<sub>,
  • SOX9 BS<sub>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories