| Primary Identifier | MGI:7720865 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr343518 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Brachyury enhancer C, overlapping a T2 gene exon and introns, was targeted using crRNAs/tracrRNAs (targeting AATGCATTCGACCATCTCAG and ACTCAAATCAGGACCTTTTG) with CRISPR/Cas9 technology, resulting in a 567 bp deletion (GRCm39:chr17:8635673-8636239). |