|  Help  |  About  |  Contact Us

Allele : Rr343518<em1Zkoz> regulatory region 343518; endonuclease-mediated mutation 1, Zbynek Kozmik

Primary Identifier  MGI:7720865 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr343518
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Brachyury enhancer C, overlapping a T2 gene exon and introns, was targeted using crRNAs/tracrRNAs (targeting AATGCATTCGACCATCTCAG and ACTCAAATCAGGACCTTTTG) with CRISPR/Cas9 technology, resulting in a 567 bp deletion (GRCm39:chr17:8635673-8636239).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • T<deltaC>,
  • T<deltaC>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele