| Primary Identifier | MGI:7720870 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr343500 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Brachyury enhancer T3, overlapping a T2 gene exon and introns, was targeted using crRNAs/tracrRNAs (targeting TTAGCAGACTCACATTAGAG and CAAATGCAGACCGCCTCCTG) with CRISPR/Cas9 technology, resulting in a 1688 bp deletion (GRCm39:chr17:8614599-8616286). This allele was generated using zygotes containing the Rr343518em1Zkoz and Rr556em2Zkoz alleles (where the C and I enhancers are deleted). |