|  Help  |  About  |  Contact Us

Allele : Tg(Taar4-Venus)HD2Tboz transgene insertion HD2, Thomas Bozza

Primary Identifier  MGI:7714927 Allele Type  Transgenic
Attribute String  Reporter Gene  Tg(Taar4-Venus)HD2Tboz
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The transgene contains the following elements: ~2.3 kb sequence from upstream of the Taar4 TSS with 5 copies of homeodomain sequence ACATAACTTTTTAATGAGTCT inserted ~2 kb upstream of the TSS, the 5' UTR exons and intron, the Venus reporter gene (including Kozak sequence GCCACCATG upstream; replaces Taar4 CDS) and 1.3 kb sequence from downstream of the Taar4 CDS.
  • mutations:
  • Insertion
  • synonyms:
  • 5xHD-deltaT4YFPtg,
  • 5xHD-deltaT4YFPtg
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories