| Primary Identifier | MGI:7664086 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Meis1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 272 (CGT) in exon 8 was changed to histidine (CAT) (p.R272H) using an sgRNA (equivalent to AAAAAGCGTCACAAAAAGCG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.815G>A:p.R272H mutation found in some restless legs syndrome (RLS) patients. |
