|  Help  |  About  |  Contact Us

Allele : Rr547<em1Gova> regulatory region 547; endonuclease-mediated mutation 1, Golnaz Vahedi

Primary Identifier  MGI:7716472 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr547
Is Recombinase  false Is Wild Type  false
molecularNote  The Ets1 super-enhancer, overlapping lncRNA Gm27162, was targeted using sgRNAs (equivalent to GGACGTTGTGCACCTAGGATTGG and ATAAACGTCAATAATGGTATAGG) with CRISPR/Cas9 technology, resulting in its deletion.
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Ets1-SE<->,
  • Ets1-SE<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories