|  Help  |  About  |  Contact Us

Allele : Nup107<em1(DhaA*)Wtd> nucleoporin 107; endonuclease-mediated mutation 1, William T Dauer

Primary Identifier  MGI:7712790 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag, Inserted expressed sequence Gene  Nup107
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A sgRNA (gagcgagcgccgagaagacccgg) was designed to insert a HaloTag with a short linker and TEV (tobacco etch virus nuclear-inclusion-a endopeptidase) site immediately upstream of the start codon of the nucleoporin 107 (Nup107) gene. HaloTag is a 33 kDa haloalkane dehalogenase encoded by the DhaA gene from Rhodococcus rhodochrous that has been mutagenized to form an irreversible covalent bond to synthetic chloroalkane ligands.
  • mutations:
  • Insertion
  • synonyms:
  • Nup107<KI>,
  • Nup107<KI>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele