|  Help  |  About  |  Contact Us

Allele : Rr541<em1Jdean> regulatory region 541; endonuclease-mediated mutation 1, Jurrien Dean

Primary Identifier  MGI:7713368 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr541
Strain of Origin  C57LB/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The uterine stromal Hand2 enhancer (located in an intron of the Hand2-os1 lncRNA gene) was targeted using sgRNAs (equivalent to CGCTGAGAGCCCTTTGCACA, TTGCACAGGGGTTTGGGCTA, AATAATTATTGAGCGCAGCT and ATTGAGCGCAGCTTGGTATC) with CRISPR/Cas9 technology, resulting in a 1017 bp deletion (GRCm39:chr8:57765552-57766568).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories