| Primary Identifier | MGI:7713368 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr541 |
| Strain of Origin | C57LB/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The uterine stromal Hand2 enhancer (located in an intron of the Hand2-os1 lncRNA gene) was targeted using sgRNAs (equivalent to CGCTGAGAGCCCTTTGCACA, TTGCACAGGGGTTTGGGCTA, AATAATTATTGAGCGCAGCT and ATTGAGCGCAGCTTGGTATC) with CRISPR/Cas9 technology, resulting in a 1017 bp deletion (GRCm39:chr8:57765552-57766568). |
