| Primary Identifier | MGI:7664135 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ctcf |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 567 (CGG) in exon 9 was changed to tryptophan (TGG) (p.R567W) using an sgRNA (equivalent to AAACATTCACCCGCCGGGTAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with autosomal dominant intellectual developmental disorder 21. |
