| Primary Identifier | MGI:7780116 | Allele Type | Endonuclease-mediated |
| Gene | Alas2 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A p.R170H missense mutation (c.509G>A) was introduced to exon 5 of the X-linked mouse Alas2 gene using homology directed repair (HDR) CRISPR/cas9 methodologies in C57BL/6NCrl blastocysts (sgRNA: GAAGTGTTGGGCAAAGGGGT). The PAM site was also changed during targeting with a linked c.522C>A (p.A174=). |
