|  Help  |  About  |  Contact Us

Allele : Alas2<em4Mdf> aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 4, Mark D Fleming

Primary Identifier  MGI:7780122 Allele Type  Endonuclease-mediated
Gene  Alas2 Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
molecularNote  Alas2 ins14 mice carry a 14 bp insertion in exon 11 of the X-linked mouse Alas2 gene that creates a frameshift. This viable C-terminal mutation allele was incidentally created during the targeting of Alas2em3Mdf. The insertion (c.1646_1647ins14 (CGAAGAAGTTAAGA), p.Val550Glufs*23) was introduced as part of non-homologous end joining (NHEJ) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC).
  • mutations:
  • Insertion
  • synonyms:
  • Alas2 ins14, V550Efs,
  • Alas2 ins14, V550Efs
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories