| Primary Identifier | MGI:7780122 | Allele Type | Endonuclease-mediated |
| Gene | Alas2 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Alas2 ins14 mice carry a 14 bp insertion in exon 11 of the X-linked mouse Alas2 gene that creates a frameshift. This viable C-terminal mutation allele was incidentally created during the targeting of Alas2em3Mdf. The insertion (c.1646_1647ins14 (CGAAGAAGTTAAGA), p.Val550Glufs*23) was introduced as part of non-homologous end joining (NHEJ) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GCATGTGTTTGACATTGCGC). |