|  Help  |  About  |  Contact Us

Allele : Alas2<em5Mdf> aminolevulinic acid synthase 2, erythroid; endonuclease-mediated mutation 5, Mark D Fleming

Primary Identifier  MGI:7780124 Allele Type  Endonuclease-mediated
Gene  Alas2 Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
molecularNote  : Alas2 del2AA (Alas2 Y175_P176del) mice carry a 6 bp (2 aa) deletion in exon 5 of the X-linked mouse Alas2 gene. This allele was incidentally created during the targeting of Alas2em1Mdf. The deletion (c.523_528del; p.Tyr175_Pro176del) was introduced as part of homology directed repair (HDR) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GAAGTGTTGGGCAAAGGGGT).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Alas2 del2AA, Alas2 Y175_P176del,
  • Alas2 del2AA, Alas2 Y175_P176del
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories