| Primary Identifier | MGI:7780124 | Allele Type | Endonuclease-mediated |
| Gene | Alas2 | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | : Alas2 del2AA (Alas2 Y175_P176del) mice carry a 6 bp (2 aa) deletion in exon 5 of the X-linked mouse Alas2 gene. This allele was incidentally created during the targeting of Alas2em1Mdf. The deletion (c.523_528del; p.Tyr175_Pro176del) was introduced as part of homology directed repair (HDR) CRISPR/cas9 processes in C57BL/6NCrl blastocysts (sgRNA: GAAGTGTTGGGCAAAGGGGT). |
