| Primary Identifier | MGI:7716897 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr549 |
| Strain of Origin | C57BL/6NCr | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Sox2 distal super-enhancer SCR, containing enhancers Rr553 and others, was targeted using sgRNAs (equivalent to TATATATGGGGTGGTTTATC and CGGGCAATGAGATAGCTTAC) with CRISPR/Cas9 technology, resulting in a 14,043 bp deletion (GRCm39:chr3:34806891-34820933). |
