|  Help  |  About  |  Contact Us

Allele : Rr598<em1Yagk> regulatory region 598; endonuclease-mediated mutation 1, Yana G Kamberov

Primary Identifier  MGI:7855985 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr598
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to CAGAATCAATATAAGCCCCAGGG and TTCTTCCGGACCATGGACTAGGG) with CRISPR/Cas9 technology, resulting in a 1486 bp deletion (GRCm39:chr1:121024265-121025750).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • mECE18<del>,
  • mECE18<KO>,
  • mECE18<del>,
  • mECE18<KO>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories