| Primary Identifier | MGI:7855976 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr597 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The En1 enhancer, located downstream in an intron of Celrr, was targeted using sgRNAs (equivalent to AAGGAACCACATCGCAAAGAGGG and CCGGGCCTCGGCCACTACTCGGG) with CRISPR/Cas9 technology, resulting in a 1674 bp deletion (GRCm39:chr1:121104405-121106078). Expression of En1 is severely reduced in mid-hindbrain and moderately reduced in palm (volar) skin. |
