| Primary Identifier | MGI:7790881 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr47972 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Cyp24a1 non-renal target cell enhancer containing vitamin-D-response-elements, located downstream, was targeted using sgRNAs (equivalent to AGAGTCGAGCGGAAATGTGCAGG and GTTTATAGAATCCAGCTTGGAGG) with CRISPR/Cas9 technology, resulting in an ~2.4 kb deletion. |