| Primary Identifier | MGI:7790911 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr590 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Cyp27b1 enhancer, located in an Eef1akmt3 (Mettl21b) intron, was targeted using sgRNAs (equivalent to CCTACCTTCCCGCTACTGTTGGG and CCCTTCCTTAGGGACTTCATGGG) with CRISPR/Cas9 technology, resulting in a 5460 bp deletion (GRCm39:chr10:126868979-126874438) that includes the start of the coding last Eef1akmt3 exon. |
