|  Help  |  About  |  Contact Us

Allele : Rr590<em3Pike> regulatory region 590; endonuclease-mediated mutation 3, J Wesley Pike

Primary Identifier  MGI:7790913 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr590
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cyp27b1 enhancer, located in an Eef1akmt3 (Mettl21b) intron, was targeted using sgRNAs (equivalent to CCTACCTTCCCGCTACTGTTGGG and GCATGCAATGGCCCTCCGTTTGG) with CRISPR/Cas9 technology, resulting in a 914 bp deletion (GRCm39:chr10:126868979-126869892) that includes the start of the coding last Eef1akmt3 exon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • M21-IKOD,
  • M21-IKOD
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories